Corning
No products found because this supplier's products are not listed.
Pradeep Ramalingam, et al., bioRxiv - Cell Biology 2020
Quote: ... 1% non-essential amino acids (Corning 25-025-CI), 10 mM HEPES (Corning 25-060-CI) ...
» View all citations
Millipore Sigma
No products found because this supplier's products are not listed.
Nicla Lorito, et al., bioRxiv - Cancer Biology 2023
Quote: ... erucic acid (C22:1; cis-13-docosenoic acid, #E3385), and palmitoleic acid (C16:1; cis-9-hexadecenoic acid, #P9417) were purchased from Sigma-Aldrich and dissolved in ethanol.
» View all citations
Cayman Chemical
No products found because this supplier's products are not listed.
Bennett W. Fox, et al., bioRxiv - Biochemistry 2023
Quote: ... cis-vaccenic acid (Cayman Chemical 20023), D13- cis-vaccenic acid (Cayman Chemical 27716) ...
» View all citations
PerkinElmer
No products found because this supplier's products are not listed.
Cited in Loss of N1-Methylation of G37 in tRNA Induces Ribosome Stalling and Reprograms Gene Expression
Isao Masuda, et al., bioRxiv - Microbiology 2021
Quote: ... and 20 μM [3H]-amino acid (Perkin Elmer, 7.5 Ci/mmol) in a buffer containing 20 mM KCl ...
» View all citations
Thermo Fisher
No products found because this supplier's products are not listed.
Adam M. Zahm, et al., bioRxiv - Synthetic Biology 2023
Quote: ... Cis-Epoxysuccinic acid was purchased from ThermoFisher Scientific ...
» View all citations
Avanti Polar Lipids
No products found because this supplier's products are not listed.
Sneha Kumari, et al., bioRxiv - Pharmacology and Toxicology 2023
Quote: ... 1,2-distearoyl-sn-glycero-3-phosphocholine and 18:1 (Δ9-Cis) PE (DOPE) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine were purchased from Avanti Polar Lipids. MOPS 3-(4-morpholino ...
» View all citations
abcam
No products found because this supplier's products are not listed.
Cited in Multiomic Approach Characterises the Neuroprotective Role of Retromer in Regulating Lysosomal Health
James L. Daly, et al., bioRxiv - Neuroscience 2022
Quote: ... CI-MPR (Abcam; ab124767 ...
» View all citations
Tocris
No products found because this supplier's products are not listed.
Vikas Arige, et al., bioRxiv - Physiology 2021
Quote: ... and ci-IP3/PM (1 μM, Tocris #6210) in imaging buffer with 0.01 % BSA in dark at room temperature ...
» View all citations
Merck
No products found because this supplier's products are not listed.
Cited in Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cells
Anastasia Yunusova, et al., bioRxiv - Molecular Biology 2021
Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
» View all citations
VWR
No products found because this supplier's products are not listed.
Lucia F. Cardo, Meng Li, bioRxiv - Developmental Biology 2021
Quote: ... 4 ml of pre-chilled (−20°C) methanol/acetic acid (3:1, VWR chemicals) was added dropwise and flicking to hom*ogenize ...
» View all citations
Becton, Dickinson and Company
No products found because this supplier's products are not listed.
Cristiane Miranda Franca, et al., bioRxiv - Bioengineering 2022
Quote: ... acid solubilized Type 1 collagen from rat tail tendon (3 mg/mL, BD Biosciences) was reconstituted in an ice bath to a final concentration of 2.5 mg/mL ...
» View all citations
Lonza
No products found because this supplier's products are not listed.
C.W.E. Embregts, et al., bioRxiv - Immunology 2021
Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
» View all citations
Cell Signaling Technology
No products found because this supplier's products are not listed.
Shu-Jung Chang, et al., bioRxiv - Microbiology 2021
Quote: Antibodies to CI-M6PR (Cell Signaling Technology, Cat. #14364), anti-FLAG M2 (Sigma ...
» View all citations
Santa Cruz
No products found because this supplier's products are not listed.
Cited in A novel antifolate suppresses growth of FPGS-deficient cells and overcomes methotrexate resistance
Felix van der Krift, et al., bioRxiv - Biochemistry 2023
Quote: ... trimetrexate hydrochloride (CI-898; Santa Cruz) were dissolved in DMSO ...
» View all citations
Roche
No products found because this supplier's products are not listed.
Liang Zhang, et al., bioRxiv - Immunology 2022
Quote: ... and Liberase CI (40 μg/ml; Roche) at 37°C for 30 min ...
» View all citations
No products found because this supplier's products are not listed.
Katherine S Stewart, et al., bioRxiv - Cell Biology 2023
Quote: ... 9-cis retinoic acid and all-trans retinoic acid (both R&D Systems) were each dissolved in 100% DMSO ...
» View all citations
Addgene
No products found because this supplier's products are not listed.
Hannes M. Beyer, et al., bioRxiv - Biochemistry 2019
Quote: ... and CI-NpuDnaB (pHBBAD113, Addgene #121912) were derived from plasmid pHBDuet139 (Addgene #121913) ...
» View all citations
Electron Microscopy Sciences
No products found because this supplier's products are not listed.
Cited in Differential tissue stiffness of body column facilitates locomotion of Hydra on solid substrates
Suyash Naik, et al., bioRxiv - Biophysics 2020
Quote: ... 1% Tannic acid (EMS) and 1 % Uranyl acetate (EMS) ...
» View all citations
New England Biolabs
No products found because this supplier's products are not listed.
Ritu Nayak, et al., bioRxiv - Cell Biology 2022
Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
» View all citations
Proteintech
No products found because this supplier's products are not listed.
Amy Krans, et al., bioRxiv - Neuroscience 2019
Quote: ... p62 (Proteintech, 1:1000, acid AR), ubiquitin (DAKO ...
» View all citations
Stemcell Technologies
No products found because this supplier's products are not listed.
Seth D. Reighard, et al., bioRxiv - Immunology 2020
Quote: ... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
» View all citations
Qiagen
No products found because this supplier's products are not listed.
Jessica Tang, et al., bioRxiv - Genomics 2020
Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
» View all citations
Polysciences
No products found because this supplier's products are not listed.
Amber L. Altrieth, et al., bioRxiv - Cell Biology 2023
Quote: ... 1% Acetic Acid (Polysciences) was pipetted directly onto the sections for one minute ...
» View all citations
Bio-Rad
No products found because this supplier's products are not listed.
Weiwei Peng, et al., bioRxiv - Immunology 2023
Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
» View all citations
GE Life Sciences
No products found because this supplier's products are not listed.
Yao Wang, et al., bioRxiv - Cell Biology 2023
Quote: ... and 6,000 Ci/mmol γ-[32P] ATP (GE Healthcare). Reactions were quenched by the addition of Laemmli sample buffer and analyzed by SDS-PAGE and autoradiography.
» View all citations
Agilent
No products found because this supplier's products are not listed.
Zhihang Yuan, et al., bioRxiv - Bioengineering 2021
Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
» View all citations
Peprotech
No products found because this supplier's products are not listed.
P Chaudhary, et al., bioRxiv - Neuroscience 2020
Quote: ... neurotrophin-3 (NT-3, 1 ng/ml, PeproTech, Rocky Hill, NJ), and ciliary neurotrophic factor (CNTF,10 ng/ml ...
» View all citations
BioLegend
No products found because this supplier's products are not listed.
Brandon M. Murphy, et al., bioRxiv - Cancer Biology 2022
Quote: ... Lag-3 (Biolegend #C9B7W; 1:250), CD3 (BD Biosciences #145-2C11 ...
» View all citations
Invivogen
No products found because this supplier's products are not listed.
Paula I Seoane, et al., bioRxiv - Microbiology 2019
Quote: ... polyinosinic-polycytidilic acid (polyIC) at 3 and 30 ng/mL (Invivogen), type-I interferon receptor inhibitor (IFNARinh ...
» View all citations
Calbiochem
No products found because this supplier's products are not listed.
Evelyne Krin, et al., bioRxiv - Microbiology 2023
Quote: ... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
» View all citations
Promega
No products found because this supplier's products are not listed.
Verena Ducret, et al., bioRxiv - Microbiology 2021
Quote: ... containing 1 mM ethylenediaminetetraacetic acid (EDTA, Promega). The culture was then induced with 2 mM ZnCl2 and a 1 mL-sample was collected at 5 ...
» View all citations
Vector Labs
No products found because this supplier's products are not listed.
Joke De Jaeger-Braet, et al., bioRxiv - Cell Biology 2021
Quote: ... the slides were washed in cold 3:1 ethanol:acetic acid and mounted in Vectashield medium with DAPI (Vector Laboratories).
» View all citations
Novus Biologicals
No products found because this supplier's products are not listed.
Amy Krans, et al., bioRxiv - Neuroscience 2019
Quote: ... ubiquilin 2 (Novus Biologicals, 1:200, acid AR), NTF1 (Abclonal ...
» View all citations
Takara Bio
No products found because this supplier's products are not listed.
Eric T. Hall, et al., bioRxiv - Cell Biology 2020
Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
» View all citations
Biotium Inc.
No products found because this supplier's products are not listed.
Laura Ann Devlin, et al., bioRxiv - Genetics 2019
Quote: ... with GelRed Nucleic Acid GelStain (1:10,000) (Biotium) at 150V for 45 min ...
» View all citations
GenScript
No products found because this supplier's products are not listed.
Cited in The SAGA core module is critical during Drosophila oogenesis and is broadly recruited to promoters
Jelly H.M. Soffers, et al., bioRxiv - Genomics 2021
Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
» View all citations
Jackson ImmunoResearch
No products found because this supplier's products are not listed.
Coralie Hérent, et al., bioRxiv - Neuroscience 2021
Quote: ... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
» View all citations
Leica
No products found because this supplier's products are not listed.
M. Dolores Martin-de-Saavedra, et al., bioRxiv - Neuroscience 2019
Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ...
» View all citations
Genetex
No products found because this supplier's products are not listed.
Cited in hom*osalate boosts the release of tumor-derived Extracellular Vesicles with anti-anoikis properties
Eleonora Grisard, et al., bioRxiv - Cell Biology 2021
Quote: ... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
» View all citations
Synaptic Systems
No products found because this supplier's products are not listed.
Yan Li, et al., bioRxiv - Neuroscience 2024
Quote: ... Unc13-3 (1:1000, Synaptic systems, 126303), Synpo1 (1:2000 ...
» View all citations
Miltenyi Biotec
No products found because this supplier's products are not listed.
Sally Martin, et al., bioRxiv - Genomics 2020
Quote: ... 1:100 B27 supplement without retinoic acid (Miltenyi Biotec) supplemented with 10 µM SB-431542 ...
» View all citations
Worthington Biochemical
Ribonucleic Acid
Primarily ribosomal RNA. Suitable substrate for ribonuclease assays.
Cat# LS003452, 100 mg, $68.00 Ask
» View all matched products (54)
Hazel Tye, et al., bioRxiv - Immunology 2023
Quote: ... 1% (w/v) fatty acid-free BSA (Worthington, USA) was prepared by dissolving fatty acid-free BSA in serum-free DMEM containing 4 μM L-glutamine ...
» View all citations
LI-COR
No products found because this supplier's products are not listed.
Daniel Camo-Escobar, et al., bioRxiv - Plant Biology 2024
Quote: Steady state Amax measurements and A/Ci curves were generated using an LI-6800 (LI-COR) photosynthesis measuring system ...
» View all citations
Illumina
No products found because this supplier's products are not listed.
Julie Zaworski, et al., bioRxiv - Genetics 2020
Quote: The phage L cI−40 13−am43 genome was sequenced at New England Biolabs by combining data from Illumina and PacBio RS2 methods ...
» View all citations
The Jackson Laboratory
No products found because this supplier's products are not listed.
Cited in Hyperactivity of indirect pathway-projecting spiny projection neurons drives compulsive behavior
Sean C Piantadosi, et al., bioRxiv - Neuroscience 2022
Quote: ... tertiary streptavidin conjugated Cy-3 (1:250 Jackson lab)].
» View all citations
Charles River Labs
No products found because this supplier's products are not listed.
Cited in Impact of a human gut microbe on Vibrio cholerae host colonization through biofilm enhancement
Kelsey Barrasso, et al., bioRxiv - Microbiology 2021
Quote: ... 3-day old suckling CD-1 mice (Charles River Laboratories) were fasted for 1 hour ...
» View all citations
Bethyl
No products found because this supplier's products are not listed.
Arne H. Smits, et al., bioRxiv - Bioengineering 2019
Quote: ... Antibody 1: Rabbit anti-BRD4 amino acids 1312-1362 (Bethyl Laboratories, #A301985A). Antibody 2 ...
» View all citations
Beckman
No products found because this supplier's products are not listed.
Tegan S. Horan, et al., bioRxiv - Genetics 2023
Quote: ... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
» View all citations
SouthernBiotech
No products found because this supplier's products are not listed.
Jeffrey L. Platt, et al., bioRxiv - Immunology 2021
Quote: ... The reaction was visualized by subsequent addition of 2,2′-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) substrate (Southern Biotech, #0202-01).
» View all citations
Rockland
No products found because this supplier's products are not listed.
Zachary Beine, et al., bioRxiv - Neuroscience 2022
Quote: ... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
» View all citations
